Chst10 antibody thermo
WebCompare Anti-CHST10 Immunohistochemistry Antibody Products from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more. WebCHST10, Rabbit anti-Human, Polyclonal Antibody, Abnova™-Rabbit Polyclonal Antibody
Chst10 antibody thermo
Did you know?
WebThere are currently no images for Carbohydrate Sulfotransferase 10/CHST10 Antibody (NBP2-97238IR). Every product we sell is backed by Novus' 100% Guarantee . If you … WebImmunohistochemical analysis of paraffin-embedded human gliomas using 12013-1-AP (CHST10 antibody) at dilution of 1:50 (under 10x lens). View All Images (2) Save time and replace your secondary antibodies with our FlexAble Antibody Labeling Kits $389 / 150 μL Cat No. 12013-1-AP In stock.
WebThere are currently no images for Carbohydrate Sulfotransferase 10/CHST10 Antibody (NBP2-97238R). Every product we sell is backed by Novus' 100% Guarantee . If you … WebCHST10 (HNK-1ST) protein expression summary. We use cookies to enhance the usability of our website. If you continue, we'll assume that you are happy to receive all cookies. ... Antibody specificity analysis with protein arrays. Predicted and matching interactions are shown in green. Antibody dilution: 1:3000: 1:500: ANTIGEN INFORMATION;
WebCHST10, Rabbit, Monoclonal Antibody, Abnova™-Rabbit monoclonal antibody raised against a human CHST10 peptide using ARM Technology. Fisher Scientific Fisher Healthcare WebFeb 2, 2013 · A Chst10 targeting vector was constructed as shown in Fig. 1. Homologously recombined ES clones were selected by Southern hybridization using a probe adjacent to the targeting vector. Probe DNA (about 450 bp) was amplified by PCR using the following primers: 5–12s, TGTAGTCAAGGCAGCAACCAAGCA, and 5–13a, …
WebATP7B Antibodies. Antibodies that detect ATP7B can be used in several scientific applications, including Western Blot, Immunocytochemistry, Immunohistochemistry, Immunoprecipitation and ELISA. These antibodies target ATP7B in Human, Rat and Mouse samples. Our ATP7B polyclonal and monoclonal antibodies are developed in Rabbit …
WebCHST10 Polyclonal Antibody Product Details Size 100 µL Species Reactivity Human, Mouse, Rat Host / Isotype Rabbit / IgG ... Conjugate Unconjugated Immunogen A synthesized peptide derived from human CHST10, corresponding to a region within the internal amino acids. Form Liquid Concentration 1mg/mL Purification Affinity … dell e525w driver windows 10WebAntibodies. Protein structure ... CHST10 is part of cluster 22 Rhabdoid cancers - Neuronal signaling with confidence i 1 291 genes in cluster Go to interactive expression cluster page. 15 nearest neighbours based on cell line RNA expression. Neighbour i. Description i. ... ferry to inchcaillochWebAntibody: Immunogen: CHST10 fusion protein Ag2627: Full Name: carbohydrate sulfotransferase 10: Calculated molecular weight: 356 aa, 42 kDa: Observed molecular … dell e5550 bluetooth driverWebA superior strategy for validation of antibody: Blocking peptide validation; Independent Antibody Verification; phospho-antibody made by Affinity; Fruit fly studies guide investigators to misregulated mechanism in human cancers; G Protein-Coupled Receptors (GPCRs) win 2012 Nobel Prize in Chemistry dell e525w cyan toner 1400 pg standard yieldWebRabbit Polyclonal CHST10 antibody Internal Region for ELISA, ICC, IF, IHC, WB. Order anti-CHST10 antibody ABIN6258961. language English local_shipping United States phone+1 877 302 8632; Contact; person Login favorite_border Comparison List shopping_cart Basket menu; north; arrow_back. search. search. Phone: +1 877 302 … dell e525w printer softwareWebFawn Creek Township is a locality in Kansas. Fawn Creek Township is situated nearby to the village Dearing and the hamlet Jefferson. Map. Directions. Satellite. Photo Map. dell e525w printer driver for windows 11WebHNK-1ST/CHST10 antibodies are validated with different applications, which are IHC-P. HNK-1ST/CHST10 cDNA Clone (13) HNK-1ST/CHST10 cDNA clones are full length sequence confirmed and expression validated. There are 13 kinds of tags for each HNK-1ST/CHST10 of different species, especially GFP tag, OFP tag, FLAG tag and so on. … dell e5570 no boot when sata cable connected